BGI 5128 PDF

*Exchange rate ref. BCCR. The supplier can change the price of the product. Aeropost is an online shopping services provider. Total price includes all charges . NM_c+A>G; NM_c+A>T . ss, BGI|BGI_rs, fwd/B, C/T, aatggcaaaatgataaattgtggtcttctg. ss, BGI|BGI_rs, rev/B, G/T, ctgttgagtgaaggctgtgttcttggaggg, agtattctttgaataaactgatgaattcca, 06/06/08, 06/18/09, , Genomic, unknown.

Author: Malaktilar Nekazahn
Country: Dominica
Language: English (Spanish)
Genre: Video
Published (Last): 5 April 2017
Pages: 370
PDF File Size: 17.53 Mb
ePub File Size: 4.6 Mb
ISBN: 416-3-54900-113-9
Downloads: 70756
Price: Free* [*Free Regsitration Required]
Uploader: Morr

Preços referenciais B3 – prêmios de opções

Crystal structure of 2-nitropropane dioxygenase complexed with FMN and substrate. The enzyme from Escherichia coli attacks a broad spectrum of phenolic compounds.

NAD P H reductase subfamily. The lined seahorse, Hippocampus erectusis an Atlantic species and mainly inhabits shallow sea beds or coral reefs. Characterization of an Escherichia coli aromatic hydroxylase with a broad substrate range. Characterization of 4-hydroxyphenylacetate 3-hydroxylase HpaB of Escherichia coli as a reduced flavin adenine dinucleotide-utilizing monooxygenase. ExplorEnz – The Enzyme Database: Appl Environ Microbiol Biochim Biophys Acta A total of Xun L, Sandvik ER.

In progress issue alert. Using homology-based, de novo and transcriptome-based prediction methods, we predicted 20 protein-coding genes in the generated assembly, which is less than our previously reported gene number 23 of the tiger tail seahorse H. J Biol Chem Active towards linear alkyl nitronates of lengths between 2 and 6 carbon atoms and, with lower activity, towards propylnitronate.

Email alerts New issue alert.

In order to improve the aquaculture yield of this valuable fish species, we are trying to develop bti resources for assistant selection in genetic breeding. C ]; other products. These generated genomic data are going to enrich genome resource of this economically important fish, and also provide insights into the genetic mechanisms of its iconic morphology and male pregnancy behavior.

Bpet Bpet Bpet Bpet Receive exclusive offers and updates from Oxford Academic. C ]; nitrite [CPD: Oxidoreductases; Acting on paired donors, with incorporation or reduction of molecular oxygen; With reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen into the other donor.

Oxidoreductases; Acting on single donors with incorporation of molecular oxygen oxygenases ; With incorporation of one atom of oxygen internal monooxygenases or internal mixed-function oxidases.

Close mobile search navigation Article navigation. Hgi evidence for an anion binding pocket in the active site of nitronate monooxygenase. Functional analysis of the small component of the 4-hydroxyphenylacetate 3-monooxygenase of Escherichia coli W: A two-protein component enzyme.

The contig N50 and scaffold N50 reached Related articles in Web of Science Google Scholar. Availability of supporting data. C ]; O2 [CPD: Francis K, Gadda G. Citing articles via Web of Science 2. Oxford University Press is a department of the University of Oxford. Involvement of a flavosemiquinone in the enzymatic oxidation of nitroalkanes catalyzed by 2-nitropropane dioxygenase. Previously classified as 2-nitropropane dioxygenase EC 1. Re analyzing community-wide datasets without major infrastructure.

Molecular characterization bgu 4-hydroxyphenylacetate 3-hydroxylase of Escherichia coli.

KEGG ORTHOLOGY: K

Characterization of the anthranilate degradation pathway in Geobacillus thermodenitrificans NG Published by Oxford University Press. Gadda G, Francis K.

Here, we provide whole genome sequencing, assembly, and gene annotation of the lined seahorse, which can enrich genome resource and further application for its molecular breeding. R R R R R It has become very popular in China for its wide use in traditional Chinese medicine.

Identification of the catalytic base. It furthers the Bgii objective of excellence in research, scholarship, and education by publishing worldwide. Neither hydrogen peroxide nor superoxide were detected during enzyme turnover. The enzyme from N.

We report a draft genome of the lined seahorse. J Biol Chem

Posted in Sex